ORK11591

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11591

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11591
Clone name	bm02539
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PPIF
cDNA sequence	DNA sequence (1564 bp) Predicted protein sequence (222 aa)
HaloTag ORF Clone	FHC11591
Flexi ORF Clone	FXC11591
Description	peptidylprolyl isomerase F

Features of the cloned cDNA sequence

Description

Length: 1564 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	873 bp
Genome contig ID	gi89161187f_80677244
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACCTTAAATGTGAAAATAAATCCTATTTTCTATGG
Flanking genome sequence (107235 - 107284)	----+--------+--------+--------+--------+----* AAGACTGGTACCTGGTTTCTGGAAGAGGGGTCTGTGACTTGGAGCTGATC

Features of the protein sequence

Description

Length: 222 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P30405	2.4e-85	100.0	Peptidyl-prolyl...	Homo sapiens
XP_507866	4.4e-85	99.5	peptidylprolyl ...	Pan troglodytes
BAG35623	6e-85	99.5	unnamed protein...	Homo sapiens
XP_001090367	3.2e-83	97.1	similar to Pept...	Macaca mulatta
Q99KR7	6.9e-75	89.8	Peptidyl-prolyl...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	22	45	PD030481	NULL
FPrintScan	IPR002130	81	96	PR00153	Peptidyl-prolyl cis-trans isomerase
	IPR002130	110	122	PR00153	Peptidyl-prolyl cis-trans isomerase
	IPR002130	153	168	PR00153	Peptidyl-prolyl cis-trans isomerase
	IPR002130	168	180	PR00153	Peptidyl-prolyl cis-trans isomerase
	IPR002130	181	196	PR00153	Peptidyl-prolyl cis-trans isomerase
HMMPfam	IPR002130	62	221	PF00160	Peptidyl-prolyl cis-trans isomerase
ProfileScan	IPR002130	64	220	PS50072	Peptidyl-prolyl cis-trans isomerase
ScanRegExp	IPR002130	105	122	PS00170	Peptidyl-prolyl cis-trans isomerase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp