Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11595
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11595
Clone name af29877
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TCF20
cDNA sequence DNA sequence (7547 bp)
Predicted protein sequence (2051 aa)
Flexi ORF Clone FXC11595
Description transcription factor 20 (AR1)
Features of the cloned cDNA sequence

Length: 7547 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1390 bp
Genome contig ID gi89161203r_40786026
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AAATCAAAAAAATAATAAACTTCATTTTAACCTTG
Flanking genome sequence
(99937 - 99888)
----+----*----+----*----+----*----+----*----+----*
TTTCCTCTTCTGTTTACTTTAAAGTGAATGCGTCTCTTCCTTCTCCCATT

Features of the protein sequence

Length: 2051 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UGU0 0 99.9 Transcription f...
Homo sapiens
EAW60495 0 99.9 transcription f...
Homo sapiens
EAW60498 0 99.3 transcription f...
Homo sapiens
EAW60497 0 99.9 transcription f...
Homo sapiens
XP_515168 0 99.1 transcription f...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR001965 1977 2024 SM00249 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp