Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11630
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11630
Clone name bm05442
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ACADVL
cDNA sequence DNA sequence (2213 bp)
Predicted protein sequence (680 aa)
Flexi ORF Clone FXC11630
Description acyl-Coenzyme A dehydrogenase, very long chain
Features of the cloned cDNA sequence

Length: 2213 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 168 bp
Genome contig ID gi51511734f_6963957
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ACTGCCTCGCAAATAATAAAAATTTCTAGCCAGTC
Flanking genome sequence
(105353 - 105402)
----+----*----+----*----+----*----+----*----+----*
ATGCTTTGCTCCTGTGTGACGGTTCTTTCCCCCTGCTGCCTGCCTCCCTC

Features of the protein sequence

Length: 680 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW90247 0 100.0 acyl-Coenzyme A...
Homo sapiens
BAG57019 0 99.8 unnamed protein...
Homo sapiens
P49748 0 100.0 Very long-chain...
Homo sapiens
BAD96238 0 99.8 acyl-Coenzyme A...
Homo sapiens
BAA29057 0 99.8 very-long-chain...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006092 120 234 PF02771 Acyl-CoA dehydrogenase
IPR006091 238 291 PF02770 Acyl-CoA dehydrogenase/oxidase
IPR006090 352 502 PF00441 Acyl-CoA dehydrogenase
ScanRegExp IPR006089 240 252 PS00072 Acyl-CoA dehydrogenase
IPR006089 460 479 PS00073 Acyl-CoA dehydrogenase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp