Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11636
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11636
Clone name ej00726
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MAN2A1
cDNA sequence DNA sequence (4065 bp)
Predicted protein sequence (1282 aa)
Flexi ORF Clone FXC11636
Description mannosidase, alpha, class 2A, member 1
Features of the cloned cDNA sequence

Length: 4065 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 159 bp
Genome contig ID gi51511721f_108953547
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGGTTTTTTCTTTTTTCTTTTACCAGTACAGTAAG
Flanking genome sequence
(277212 - 277261)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAGCCATGCTATCAATCAAGATTCTTTTTTT

Features of the protein sequence

Length: 1282 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q16706 0 100.0 Alpha-mannosida...
Homo sapiens
AAC50302 0 99.9 alpha mannosida...
Homo sapiens
BAA10017 0 99.9 golgi alpha-man...
Homo sapiens
XP_517864 0 99.8 mannosidase, al...
Pan troglodytes
AAI42657 0 99.8 MAN2A1 protein ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000602 305 636 PF01074 Glycoside hydrolase
IPR015341 640 726 PF09261 Glycoside hydrolase
IPR011682 786 1278 PF07748 Glycosyl hydrolases 38
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp