ORK11637

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11637

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11637
Clone name	fj03204
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	QSOX2
cDNA sequence	DNA sequence (4533 bp) Predicted protein sequence (705 aa)
HaloTag ORF Clone	FHC11637
Flexi ORF Clone	FXC11637
Description	quiescin Q6 sulfhydryl oxidase 2

Features of the cloned cDNA sequence

Description

Length: 4533 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2414 bp
Genome contig ID	gi89161216r_138138006
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AATGTGCACATTTTAATAAAGAAATCTGACATTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAATGGTGATTCTTTTGAAATGTGAACCAGCTCTACCAGTGGGAGTT

Features of the protein sequence

Description

Length: 705 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZRP7	100.0	Sulfhydryl oxid...	Homo sapiens
XP_520361	97.8	quiescin Q6-lik...	Pan troglodytes
CAC85331	97.4	putative sulfhy...	Homo sapiens
AAH47604	93.2	QSOX2 protein [...	Homo sapiens
BAC87262	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006662	89	97	PR00421	Thioredoxin-related
	IPR006662	97	106	PR00421	Thioredoxin-related
	IPR006662	142	153	PR00421	Thioredoxin-related
HMMPfam	IPR013766	83	154	PF00085	Thioredoxin domain
HMMPfam	IPR006863	439	537	PF04777	Erv1/Alr

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	661	VDFSSLDMSLCVVLYVASSLFLM	683	PRIMARY	23