Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11639
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11639
Clone name pj01087
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DLGAP3
cDNA sequence DNA sequence (3705 bp)
Predicted protein sequence (985 aa)
Flexi ORF Clone FXC11639
Description discs, large (Drosophila) homolog-associated protein 3
Features of the cloned cDNA sequence

Length: 3705 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 646 bp
Genome contig ID gi89161185r_35003625
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGAATATCCCAGGAAAAATAAAACGGCAGAACTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTCGAGCCAGCTGCTCTCTCCAGAAGAGGCCACCTCCGTCCCGTGTGTG

Features of the protein sequence

Length: 985 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O95886 0 100.0 Disks large-ass...
Homo sapiens
XP_001108687 0 98.6 discs, large (D...
Macaca mulatta
XP_594206 0 97.7 similar to disc...
Bos taurus
XP_001503759 0 97.8 discs, large (D...
Equus caballus
EAX07436 0 100.0 hCG37763 [Homo ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005026 627 985 PF03359 Guanylate-kinase-associated protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp