Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11640
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11640
Clone name ee22834
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF182
cDNA sequence DNA sequence (3556 bp)
Predicted protein sequence (686 aa)
Flexi ORF Clone FXC11640
Description zinc finger protein 182
Features of the cloned cDNA sequence

Length: 3556 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1318 bp
Genome contig ID gi89161218r_47619195
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TACTACCTTTTCAAAAATAAAACATTTAAAAAGCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTGTTTTACTGTTATAGTAAAGTCACAGTCTAGGTACAGGATTTTAT

Features of the protein sequence

Length: 686 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P17025 0 100.0 Zinc finger pro...
Homo sapiens
XP_001095701 0 98.4 similar to zinc...
Macaca mulatta
EAW59336 0 95.8 zinc finger pro...
Homo sapiens
CAC41951 0 99.6 zinc finger pro...
Homo sapiens
BAG61332 0 99.5 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 281 304 PD000003 Zinc finger
IPR007087 309 332 PD000003 Zinc finger
IPR007087 337 360 PD000003 Zinc finger
IPR007087 365 388 PD000003 Zinc finger
IPR007087 421 444 PD000003 Zinc finger
IPR007087 449 472 PD000003 Zinc finger
IPR007087 477 500 PD000003 Zinc finger
IPR007087 505 528 PD000003 Zinc finger
IPR007087 533 556 PD000003 Zinc finger
IPR007087 561 584 PD000003 Zinc finger
IPR007087 589 612 PD000003 Zinc finger
IPR007087 617 640 PD000003 Zinc finger
IPR007087 645 667 PD000003 Zinc finger
HMMPfam IPR001909 74 114 PF01352 KRAB box
IPR007087 281 303 PF00096 Zinc finger
IPR007087 309 331 PF00096 Zinc finger
IPR007087 337 359 PF00096 Zinc finger
IPR007087 365 387 PF00096 Zinc finger
IPR007087 393 415 PF00096 Zinc finger
IPR007087 421 443 PF00096 Zinc finger
IPR007087 449 471 PF00096 Zinc finger
IPR007087 477 499 PF00096 Zinc finger
IPR007087 505 527 PF00096 Zinc finger
IPR007087 533 555 PF00096 Zinc finger
IPR007087 561 583 PF00096 Zinc finger
IPR007087 589 611 PF00096 Zinc finger
IPR007087 617 639 PF00096 Zinc finger
IPR007087 645 667 PF00096 Zinc finger
HMMSmart IPR001909 74 134 SM00349 KRAB box
IPR015880 281 303 SM00355 Zinc finger
IPR015880 309 331 SM00355 Zinc finger
IPR015880 337 359 SM00355 Zinc finger
IPR015880 365 387 SM00355 Zinc finger
IPR015880 393 415 SM00355 Zinc finger
IPR015880 421 443 SM00355 Zinc finger
IPR015880 449 471 SM00355 Zinc finger
IPR015880 477 499 SM00355 Zinc finger
IPR015880 505 527 SM00355 Zinc finger
IPR015880 533 555 SM00355 Zinc finger
IPR015880 561 583 SM00355 Zinc finger
IPR015880 589 611 SM00355 Zinc finger
IPR015880 617 639 SM00355 Zinc finger
IPR015880 645 667 SM00355 Zinc finger
ProfileScan IPR001909 74 145 PS50805 KRAB box
IPR007087 253 280 PS50157 Zinc finger
IPR007087 281 308 PS50157 Zinc finger
IPR007087 309 336 PS50157 Zinc finger
IPR007087 337 364 PS50157 Zinc finger
IPR007087 365 392 PS50157 Zinc finger
IPR007087 393 420 PS50157 Zinc finger
IPR007087 421 448 PS50157 Zinc finger
IPR007087 449 476 PS50157 Zinc finger
IPR007087 477 504 PS50157 Zinc finger
IPR007087 505 532 PS50157 Zinc finger
IPR007087 533 560 PS50157 Zinc finger
IPR007087 561 588 PS50157 Zinc finger
IPR007087 589 616 PS50157 Zinc finger
IPR007087 617 644 PS50157 Zinc finger
IPR007087 645 672 PS50157 Zinc finger
ScanRegExp IPR007087 283 303 PS00028 Zinc finger
IPR007087 311 331 PS00028 Zinc finger
IPR007087 339 359 PS00028 Zinc finger
IPR007087 367 387 PS00028 Zinc finger
IPR007087 395 415 PS00028 Zinc finger
IPR007087 423 443 PS00028 Zinc finger
IPR007087 451 471 PS00028 Zinc finger
IPR007087 479 499 PS00028 Zinc finger
IPR007087 507 527 PS00028 Zinc finger
IPR007087 535 555 PS00028 Zinc finger
IPR007087 563 583 PS00028 Zinc finger
IPR007087 591 611 PS00028 Zinc finger
IPR007087 619 639 PS00028 Zinc finger
IPR007087 647 667 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp