Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11641
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11641
Clone name ej00868
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ARHGAP18
cDNA sequence DNA sequence (4391 bp)
Predicted protein sequence (673 aa)
Flexi ORF Clone FXC11641
Description Rho GTPase activating protein 18
Features of the cloned cDNA sequence

Length: 4391 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2369 bp
Genome contig ID gi89161210r_129838983
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
TGTGTATGAGACAAAATAAAAATAAATATATTTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTGAGTTTAAAACATTTGAATTCTTAAAGGAGGACTGGTTGTCCTGGTA

Features of the protein sequence

Length: 673 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8N392 0 100.0 Rho GTPase-acti...
Homo sapiens
NP_277050 0 99.8 rho GTPase-acti...
Homo sapiens
AAT64914 0 99.6 rho GTPase acti...
Homo sapiens
XP_518735 0 99.0 hypothetical pr...
Pan troglodytes
XP_001168191 0 98.9 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000198 353 502 PF00620 RhoGAP
HMMSmart IPR000198 350 530 SM00324 RhoGAP
ProfileScan IPR000198 334 533 PS50238 RhoGAP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp