ORK11645

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11645

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11645
Clone name	hk07083
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RFX1
cDNA sequence	DNA sequence (4320 bp) Predicted protein sequence (994 aa)
HaloTag ORF Clone	FHC11645
Flexi ORF Clone	FXC11645
Description	regulatory factor X, 1 (influences HLA class II expression)

Features of the cloned cDNA sequence

Description

Length: 4320 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1165 bp
Genome contig ID	gi42406306r_13833343
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TCTTAAAACAATAAATTCCGCTGTGATATTTGCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGCTGACTCGCCGGGCCTTGGTGGGGGCCTTGGGGCGGGGGCTCCAGC

Features of the protein sequence

Description

Length: 994 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P22670	0	100.0	MHC class II re...	Homo sapiens
EAW84387	0	99.8	regulatory fact...	Homo sapiens
XP_524133	0	99.7	regulatory fact...	Pan troglodytes
XP_542024	2.1e-208	95.2	similar to MHC ...	Canis lupus fam...
EDL92240	6.9e-188	92.4	regulatory fact...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007668	230	393	PF04589	RFX1 transcription activation region
HMMPfam	IPR003150	436	518	PF02257	DNA-binding RFX

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp