ORK11648

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11648

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11648
Clone name	ha00065s1
Vector information	The cDNA fragment (ha00065s1) was cloned at SacI-XhoI of the ... The cDNA fragment (ha00065s1) was cloned at SacI-XhoI of the pNTT104 vector (GenBank Accession No. AB032066). The 5' end of the cDNA was ligated with a multiple linker fragment (5'GAGCTCTCCC ATATGGTCGA CCTGCAGGCG GCCGCGAATT CACTAGTGAT T3') and inserted at the SacI site of the vector. The 3' end of the cDNA was inserted at the XhoI site of the vector
Symbol	KTN1
cDNA sequence	DNA sequence (4399 bp) Predicted protein sequence (1307 aa)
HaloTag ORF Clone	FHC11648
Flexi ORF Clone	FXC11648
Description	kinectin 1 (kinesin receptor)

Features of the cloned cDNA sequence

Description

Length: 4399 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	471 bp
Genome contig ID	gi51511730f_55048495
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TAATGGCGTCACAAATAAAAGGATGCTTATTATTC
Flanking genome sequence (172554 - 172603)	----+--------+--------+--------+--------+----* AAACTTGACTTGTTCTAATTTTTATTGAGCTTTAACAGATTTCATTAGTA

Features of the protein sequence

Description

Length: 1307 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAB65853	100.0	kinectin [Homo ...	Homo sapiens
AAI51336	88.6	KTN1 protein [B...	Bos taurus
AAI17133	96.0	Kinectin 1 (kin...	Homo sapiens
BAG64000	97.8	unnamed protein...	Homo sapiens
Q86UP2	95.8	Kinectin; Kines...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	14	AYFIVLIPSIVITVIFLFFWLFM	36	PRIMARY	23