ORK11650

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11650

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11650
Clone name	ff14788
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NPAT
cDNA sequence	DNA sequence (5766 bp) Predicted protein sequence (1440 aa)
HaloTag ORF Clone	FHC11650
Flexi ORF Clone	FXC11650
Description	nuclear protein, ataxia-telangiectasia locus

Features of the cloned cDNA sequence

Description

Length: 5766 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1361 bp
Genome contig ID	gi51511727r_107433519
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TTTAAAAAAATAAATCCATCCAACTTTAACACAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCTCAGTGTAGAAATCATGTCTTCTTAATTGCTGAACCTTACTGCAA

Features of the protein sequence

Description

Length: 1440 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA11861	100.0	NPAT [Homo sapi...	Homo sapiens
EAW67107	99.9	nuclear protein...	Homo sapiens
Q14207	99.8	Protein NPAT; N...	Homo sapiens
AAI36271	99.9	Nuclear protein...	Homo sapiens
EAW67106	99.6	nuclear protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006594	16	48	SM00667	LisH dimerisation motif
ProfileScan	IPR006594	16	48	PS50896	LisH dimerisation motif

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	4	LIVVPAVVLIMLLPSDVARLVLG	26	PRIMARY	23