ORK11781

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11781

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11781
Clone name	bm02595
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	HTRA1
cDNA sequence	DNA sequence (2012 bp) Predicted protein sequence (487 aa)
Description	Serine protease HTRA1 Precursor (EC 3.4.21.-)(L56)(Serine protease 11)

Features of the cloned cDNA sequence

Description

Length: 2012 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	548 bp
Genome contig ID	gi89161187f_124111138
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TGAGTTTGAGCTATTAAAGTACTTCTTACACATTG
Flanking genome sequence (153277 - 153326)	----+--------+--------+--------+--------+----* CTTTCTGTAGTGCTTATTTTCCTTTCCCAAGAGCAGCTTGTTGCAGTCTT

Features of the protein sequence

Description

Length: 487 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q92743	4.5e-183	100.0	Serine protease...	Homo sapiens
XP_001103628	1.9e-181	99.1	HtrA serine pep...	Macaca mulatta
XP_612097	7.5e-169	92.3	HtrA serine pep...	Bos taurus
ABP81865	8.7e-168	92.2	serine protease...	Mesocricetus au...
AAD52682	1.3e-167	92.2	insulin-like gr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001940	220	232	PR00834	Peptidase S1C
	IPR001940	241	261	PR00834	Peptidase S1C
	IPR001940	282	306	PR00834	Peptidase S1C
	IPR001940	320	337	PR00834	Peptidase S1C
	IPR001940	342	359	PR00834	Peptidase S1C
	IPR001940	434	446	PR00834	Peptidase S1C
HMMPfam	IPR011497	116	162	PF07648	Protease inhibitor
	IPR001254	206	371	PF00089	Peptidase S1 and S6
	IPR001478	418	470	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR000867	42	119	SM00121	Insulin-like growth factor-binding protein
	IPR002350	116	162	SM00280	Proteinase inhibitor I1
	IPR001478	388	473	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	372	461	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	10	IPRAALLPLLLLLLAAPASAQLS	32	PRIMARY	23