ORK11783

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11783

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11783
Clone name	bm03186
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	HSD17B11
cDNA sequence	DNA sequence (1650 bp) Predicted protein sequence (314 aa)
HaloTag ORF Clone	FHC11783
Flexi ORF Clone	FXC11783
Description	Estradiol 17-beta-dehydrogenase 11 Precursor (EC 1.1.1.62)(17-beta-hydroxysteroid dehydrogenase 11)(17-beta-HSD 11)(17betaHSD11)(17bHSD11)(17-beta-HSD XI)(17betaHSDXI)(Dehydrogenase/reductase SDR family member 8)(Retinal short-chain dehydrogenase/reductase 2)(retSDR2)(Cutaneous T-cell lymphoma-associated antigen HD-CL-03)(CTCL tumor antigen HD-CL-03)

Features of the cloned cDNA sequence

Description

Length: 1650 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	664 bp
Genome contig ID	gi89161207r_88376789
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCACAAATGGCAGCAATAATAAATGGATCACACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTTTGGTGTTTCCATCTTTTTGTCTTAAACAGAACATGACAACCTT

Features of the protein sequence

Description

Length: 314 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8NBQ5	5e-123	100.0	Estradiol 17-be...	Homo sapiens
BAC11560	1.3e-122	99.6	unnamed protein...	Homo sapiens
NP_057329	1.3e-122	99.6	estradiol 17-be...	Homo sapiens
Q5NVG2	4.6e-122	98.6	Estradiol 17-be...	Pongo abelii
AAH08650	9e-119	97.3	HSD17B11 protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002347	52	69	PR00081	Glucose/ribitol dehydrogenase
	IPR002347	126	137	PR00081	Glucose/ribitol dehydrogenase
	IPR002198	126	137	PR00080	Short-chain dehydrogenase/reductase SDR
	IPR002347	173	189	PR00081	Glucose/ribitol dehydrogenase
	IPR002198	179	187	PR00080	Short-chain dehydrogenase/reductase SDR
	IPR002347	199	218	PR00081	Glucose/ribitol dehydrogenase
	IPR002198	199	218	PR00080	Short-chain dehydrogenase/reductase SDR
	IPR002347	223	240	PR00081	Glucose/ribitol dehydrogenase
HMMPfam	IPR002198	51	218	PF00106	Short-chain dehydrogenase/reductase SDR

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	18	LLDILLLLPLLIVCSLESFVKLF	40	PRIMARY	23