ORK11785

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11785

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11785
Clone name	bm04385
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CYB5R1
cDNA sequence	DNA sequence (1616 bp) Predicted protein sequence (320 aa)
HaloTag ORF Clone	FHC11785
Flexi ORF Clone	FXC11785
Description	NADH-cytochrome b5 reductase 1 (b5R.1)(EC 1.6.2.2)(NAD(P)H:quinone oxidoreductase type 3 polypeptide A2)(Humb5R2)

Features of the cloned cDNA sequence

Description

Length: 1616 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	651 bp
Genome contig ID	gi89161185r_201097627
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- CAAATAAATGGGGCTGAGGCCCCTGTGTGATATTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGGGTTGTTGTGTCTGGGGTCCTTGTTTCCAAATCCCCGAGGACCTAG

Features of the protein sequence

Description

Length: 320 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UHQ9	3.1e-128	100.0	NADH-cytochrome...	Homo sapiens
EAW91453	6.7e-128	99.6	cytochrome b5 r...	Homo sapiens
XP_001105252	9.1e-128	99.3	similar to NAD(...	Macaca mulatta
BAD97136	1.4e-127	99.6	NAD(P)H:quinone...	Homo sapiens
BAC11115	1.7e-127	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001834	90	101	PR00406	NADH:cytochrome b5 reductase (CBR)
	IPR001709	111	118	PR00371	Flavoprotein pyridine nucleotide cytochrome reductase
	IPR001834	111	118	PR00406	NADH:cytochrome b5 reductase (CBR)
	IPR001709	143	152	PR00371	Flavoprotein pyridine nucleotide cytochrome reductase
	IPR001834	156	170	PR00406	NADH:cytochrome b5 reductase (CBR)
	IPR001709	195	214	PR00371	Flavoprotein pyridine nucleotide cytochrome reductase
	IPR001834	195	214	PR00406	NADH:cytochrome b5 reductase (CBR)
	IPR001709	233	244	PR00371	Flavoprotein pyridine nucleotide cytochrome reductase
	IPR001834	233	244	PR00406	NADH:cytochrome b5 reductase (CBR)
	IPR001709	265	281	PR00371	Flavoprotein pyridine nucleotide cytochrome reductase
	IPR001709	289	297	PR00371	Flavoprotein pyridine nucleotide cytochrome reductase
	IPR001834	289	297	PR00406	NADH:cytochrome b5 reductase (CBR)
HMMPfam	IPR008333	63	170	PF00970	Oxidoreductase FAD-binding region
HMMPfam	IPR001433	195	304	PF00175	Oxidoreductase FAD/NAD(P)-binding

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	20	TSPVLLASLGVGLVTLLGLAVGS	42	PRIMARY	23