Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11786
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11786
Clone name bm04457
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ALDOC
cDNA sequence DNA sequence (1596 bp)
Predicted protein sequence (395 aa)
Description Fructose-bisphosphate aldolase C (EC 4.1.2.13)(Brain-type aldolase)
Features of the cloned cDNA sequence

Length: 1596 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 408 bp
Genome contig ID gi51511734r_23824263
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CATACCATACAGCAAATAAATGGTAGCAAAACATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTACTTTGCCTGTCTGTTTTACACATCAAATTCCCACCTCCCAGTTTCTG

Features of the protein sequence

Length: 395 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI03761 4.5e-165 100.0 ALDOC protein [...
Homo sapiens
BAH12245 1.3e-164 99.7 unnamed protein...
Homo sapiens
P09972 2.3e-151 100.0 Fructose-bispho...
Homo sapiens
AAP36592 2.3e-151 100.0 aldolase C, fru...
synthetic construct
CAA30270 4.2e-151 99.7 fructose bispho...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000741 71 155 PD001128 Fructose-bisphosphate aldolase
HMMPfam IPR000741 46 395 PF00274 Fructose-bisphosphate aldolase
ScanRegExp IPR000741 253 263 PS00158 Fructose-bisphosphate aldolase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp