ORK11786

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11786

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11786
Clone name	bm04457
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ALDOC
cDNA sequence	DNA sequence (1596 bp) Predicted protein sequence (395 aa)
Description	Fructose-bisphosphate aldolase C (EC 4.1.2.13)(Brain-type aldolase)

Features of the cloned cDNA sequence

Description

Length: 1596 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	408 bp
Genome contig ID	gi51511734r_23824263
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CATACCATACAGCAAATAAATGGTAGCAAAACATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTACTTTGCCTGTCTGTTTTACACATCAAATTCCCACCTCCCAGTTTCTG

Features of the protein sequence

Description

Length: 395 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI03761	4.5e-165	100.0	ALDOC protein [...	Homo sapiens
BAH12245	1.3e-164	99.7	unnamed protein...	Homo sapiens
P09972	2.3e-151	100.0	Fructose-bispho...	Homo sapiens
AAP36592	2.3e-151	100.0	aldolase C, fru...	synthetic construct
CAA30270	4.2e-151	99.7	fructose bispho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000741	71	155	PD001128	Fructose-bisphosphate aldolase
HMMPfam	IPR000741	46	395	PF00274	Fructose-bisphosphate aldolase
ScanRegExp	IPR000741	253	263	PS00158	Fructose-bisphosphate aldolase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp