Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11787
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11787
Clone name bm05049
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol FBXO44
cDNA sequence DNA sequence (1737 bp)
Predicted protein sequence (251 aa)
Flexi ORF Clone FXC11787
Description F-box only protein 44 (F-box/G-domain protein 3)(F-box protein FBX30)
Features of the cloned cDNA sequence

Length: 1737 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 981 bp
Genome contig ID gi89161185f_11537546
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TACTGCATGCAGCCAAATAAAAGGTGTGCCCAGTC
Flanking genome sequence
(107388 - 107437)
----+----*----+----*----+----*----+----*----+----*
TAACCTGTGCCCTGTGGTTTCTGGAAGGAAAGGCAGACTTTAGGTGGTCC

Features of the protein sequence

Length: 251 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAG09623 1.2e-94 100.0 F-box protein F...
Homo sapiens
XP_001137637 9.6e-94 99.1 F-box protein 4...
Pan troglodytes
CAM14912 5e-82 87.5 F-box protein 4...
Mus musculus
CAQ52211 1e-80 86.1 F-box protein 4...
Mus musculus
CAI20210 2.8e-67 100.0 F-box protein 4...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001810 31 79 PF00646 Cyclin-like F-box
IPR007397 95 150 PF04300 F-box associated region
HMMSmart IPR001810 36 77 SM00256 Cyclin-like F-box
ProfileScan IPR001810 30 77 PS50181 Cyclin-like F-box
IPR007397 98 150 PS51114 F-box associated region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp