ORK11789

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11789

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11789
Clone name	bm05515
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	B3GALT2
cDNA sequence	DNA sequence (2367 bp) Predicted protein sequence (465 aa)
HaloTag ORF Clone	FHC11789
Flexi ORF Clone	FXC11789
Description	Beta-1,3-galactosyltransferase 2 (Beta-1,3-GalTase 2)(Beta3Gal-T2)(EC 2.4.1.-)(UDP-galactose:2-acetamido-2-deoxy-D-glucose 3beta-galactosyltransferase 2)

Features of the cloned cDNA sequence

Description

Length: 2367 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	423 bp
Genome contig ID	gi89161185r_191315624
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TAATTTAATGTAAATAAAACATCACTATCAATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGAAACTTTTTAATTGTGCAAAGGATAAATTTTTTGACCTATTTTAGG

Features of the protein sequence

Description

Length: 465 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O43825	5.9e-194	100.0	Beta-1,3-galact...	Homo sapiens
XP_001112579	1.3e-193	99.7	similar to UDP-...	Macaca mulatta
AAG60610	1.6e-193	99.7	B3GALT2 [Homo s...	Homo sapiens
Q5R5Y3	2.1e-193	99.7	Beta-1,3-galact...	Pongo abelii
XP_849233	4.4e-192	98.8	similar to UDP-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002659	208	402	PF01762	Glycosyl transferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	66	FRTHLIGVLSLVFLFAMFLFFN	87	PRIMARY	22