ORK11792

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11792

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11792
Clone name	bn02132
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	AIP
cDNA sequence	DNA sequence (1193 bp) Predicted protein sequence (360 aa)
HaloTag ORF Clone	FHC11792
Flexi ORF Clone	FXC11792
Description	AH receptor-interacting protein (AIP)(Aryl-hydrocarbon receptor-interacting protein)(Immunophilin homolog ARA9)(HBV X-associated protein 2)(XAP-2)

Features of the cloned cDNA sequence

Description

Length: 1193 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	110 bp
Genome contig ID	gi51511727f_66907116
PolyA signal sequence (TATAAA,-24)	+--------+--------+----*----+---- GCTTCTGTGTATATAAAGGCCTTTATTTATCTCTC
Flanking genome sequence (108036 - 108085)	----+--------+--------+--------+--------+----* TCTGAGTCTGCTGAGCTGCTCCACTGGGAGAGCCGGGTCATCACCTGGCA

Features of the protein sequence

Description

Length: 360 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O00170	1.4e-135	100.0	AH receptor-int...	Homo sapiens
AAB39923	2.5e-135	99.6	HBV-X associate...	Homo sapiens
AAY18891	4.1e-135	100.0	ARA9 [synthetic...	synthetic construct
XP_508597	5.2e-135	99.3	aryl hydrocarbo...	Pan troglodytes
ACN38897	6.1e-135	99.3	aryl hydrocarbo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001179	53	120	PF00254	Peptidyl-prolyl cis-trans isomerase
HMMPfam	IPR013105	295	328	PF07719	Tetratricopeptide TPR_2
ProfileScan	IPR001179	61	114	PS50059	Peptidyl-prolyl cis-trans isomerase
	IPR013026	295	328	PS50005	Tetratricopeptide region
	IPR013026	295	328	PS50293	Tetratricopeptide region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp