ORK11796

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11796

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11796
Clone name	ee03983
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	TRIM39
cDNA sequence	DNA sequence (3243 bp) Predicted protein sequence (489 aa)
HaloTag ORF Clone	FHC11796
Flexi ORF Clone	FXC11796
Description	Tripartite motif-containing protein 39 (RING finger protein 23)(Testis-abundant finger protein)

Features of the cloned cDNA sequence

Description

Length: 3243 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1207 bp
Genome contig ID	gi89161210f_30302235
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTCATGTTAGGCCAAAATAAACAACTTATAGGGT
Flanking genome sequence (116989 - 117038)	----+--------+--------+--------+--------+----* ACATATGTTGTCATAAAAGGTAAAAGTGATGCATGCCAAACCAAACTAAA

Features of the protein sequence

Description

Length: 489 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH07661	4.1e-178	100.0	TRIM39 protein ...	Homo sapiens
AAP36295	4.1e-178	100.0	tripartite moti...	synthetic construct
BAD83393	7e-178	99.7	tripartite moti...	Sus scrofa
BAE01252	1.3e-177	99.7	unnamed protein...	Macaca fascicularis
XP_538824	2.6e-177	99.3	similar to trip...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	116	133	PR01406	Zinc finger
	IPR000315	135	149	PR01406	Zinc finger
	IPR003879	306	323	PR01407	Butyrophylin-like
	IPR003879	323	340	PR01407	Butyrophylin-like
	IPR003879	346	370	PR01407	Butyrophylin-like
	IPR003879	376	389	PR01407	Butyrophylin-like
	IPR003879	420	444	PR01407	Butyrophylin-like
	IPR003879	450	468	PR01407	Butyrophylin-like
HMMPfam	IPR001841	30	70	PF00097	Zinc finger
	IPR000315	103	144	PF00643	Zinc finger
	IPR003877	361	486	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR001841	30	70	SM00184	Zinc finger
	IPR000315	103	144	SM00336	Zinc finger
	IPR006574	307	360	SM00589	SPRY-associated
	IPR003877	361	486	SM00449	SPla/RYanodine receptor SPRY
ProfileScan	IPR001841	30	71	PS50089	Zinc finger
	IPR000315	103	144	PS50119	Zinc finger
	IPR001870	290	485	PS50188	B302
ScanRegExp	IPR001841	45	54	PS00518	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp