Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11801
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11801
Clone name eg01330
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SLIT2
cDNA sequence DNA sequence (6634 bp)
Predicted protein sequence (1562 aa)
Description Slit homolog 2 protein Precursor (Slit-2) [Contains Slit homolog 2 protein N-product;Slit homolog 2 protein C-product]
Features of the cloned cDNA sequence

Length: 6634 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 157 bp
Genome contig ID gi89161207f_19762650
PolyA signal sequence
(AATAAA,-26)		 
+----*----+----*----+----*----+----
TATTATGAGAATAAAGACTTTTTTTCTGCATTTGG
Flanking genome sequence
(467239 - 467288)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGAAATGCTTGAACTAAAGCTTCCCCTATGCTGGAGAA

Features of the protein sequence

Length: 1562 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O94813 0 100.0 Slit homolog 2 ...
 Homo sapiens
XP_001163449 0 99.7 slit homolog 2 ...
 Pan troglodytes
EAW92793 0 99.4 slit homolog 2 ...
 Homo sapiens
AAD25539 0 99.1 SLIT2 [Homo sap...
 Homo sapiens
XP_001163334 0 99.2 slit homolog 2 ...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001611 359 372 PR00019 Leucine-rich repeat
IPR001611 590 603 PR00019 Leucine-rich repeat
HMMPfam IPR000372 60 87 PF01462 Leucine-rich repeat
IPR001611 89 111 PF00560 Leucine-rich repeat
IPR001611 113 135 PF00560 Leucine-rich repeat
IPR001611 137 157 PF00560 Leucine-rich repeat
IPR001611 161 183 PF00560 Leucine-rich repeat
IPR001611 185 207 PF00560 Leucine-rich repeat
IPR001611 209 231 PF00560 Leucine-rich repeat
IPR000483 266 291 PF01463 Cysteine-rich flanking region
IPR000372 305 332 PF01462 Leucine-rich repeat
IPR001611 334 356 PF00560 Leucine-rich repeat
IPR001611 358 380 PF00560 Leucine-rich repeat
IPR001611 382 404 PF00560 Leucine-rich repeat
IPR001611 406 428 PF00560 Leucine-rich repeat
IPR001611 430 452 PF00560 Leucine-rich repeat
IPR000483 487 512 PF01463 Cysteine-rich flanking region
IPR000372 538 565 PF01462 Leucine-rich repeat
IPR001611 592 614 PF00560 Leucine-rich repeat
IPR001611 640 662 PF00560 Leucine-rich repeat
IPR001611 664 686 PF00560 Leucine-rich repeat
IPR000372 759 786 PF01462 Leucine-rich repeat
IPR001611 788 809 PF00560 Leucine-rich repeat
IPR001611 811 833 PF00560 Leucine-rich repeat
IPR001611 835 857 PF00560 Leucine-rich repeat
IPR001611 859 881 PF00560 Leucine-rich repeat
IPR000483 916 941 PF01463 Cysteine-rich flanking region
IPR006209 955 987 PF00008 EGF-like
IPR006209 994 1028 PF00008 EGF-like
IPR006209 1035 1066 PF00008 EGF-like
IPR006209 1073 1106 PF00008 EGF-like
IPR006209 1113 1144 PF00008 EGF-like
IPR006209 1158 1189 PF00008 EGF-like
IPR012680 1221 1349 PF02210 Laminin G
IPR006209 1369 1400 PF00008 EGF-like
IPR006209 1449 1480 PF00008 EGF-like
HMMSmart IPR000372 60 92 SM00013 Leucine-rich repeat
IPR003591 86 110 SM00369 Leucine-rich repeat
IPR003591 111 134 SM00369 Leucine-rich repeat
IPR003591 135 158 SM00369 Leucine-rich repeat
IPR003591 159 182 SM00369 Leucine-rich repeat
IPR003591 187 206 SM00369 Leucine-rich repeat
IPR003591 207 230 SM00369 Leucine-rich repeat
IPR000483 242 291 SM00082 Cysteine-rich flanking region
IPR000372 305 337 SM00013 Leucine-rich repeat
IPR003591 331 355 SM00369 Leucine-rich repeat
IPR003591 356 379 SM00369 Leucine-rich repeat
NULL 356 377 SM00365 NULL
IPR003591 380 403 SM00369 Leucine-rich repeat
IPR003591 404 427 SM00369 Leucine-rich repeat
NULL 428 446 SM00365 NULL
IPR003591 428 451 SM00369 Leucine-rich repeat
IPR000483 463 512 SM00082 Cysteine-rich flanking region
IPR000372 538 570 SM00013 Leucine-rich repeat
NULL 590 611 SM00365 NULL
IPR003591 590 613 SM00369 Leucine-rich repeat
NULL 638 659 SM00365 NULL
IPR003591 638 661 SM00369 Leucine-rich repeat
NULL 662 683 SM00365 NULL
IPR003591 662 685 SM00369 Leucine-rich repeat
IPR000483 697 746 SM00082 Cysteine-rich flanking region
IPR000372 759 791 SM00013 Leucine-rich repeat
NULL 809 830 SM00365 NULL
IPR003591 809 832 SM00369 Leucine-rich repeat
IPR003591 833 856 SM00369 Leucine-rich repeat
IPR003591 857 880 SM00369 Leucine-rich repeat
IPR000483 892 941 SM00082 Cysteine-rich flanking region
IPR001881 951 988 SM00179 EGF-like calcium-binding
IPR006210 954 988 SM00181 EGF
IPR006210 993 1029 SM00181 EGF
IPR001881 994 1029 SM00179 EGF-like calcium-binding
IPR001881 1031 1067 SM00179 EGF-like calcium-binding
IPR003645 1034 1056 SM00274 Follistatin-like
IPR006210 1034 1067 SM00181 EGF
IPR001881 1069 1107 SM00179 EGF-like calcium-binding
IPR006210 1072 1107 SM00181 EGF
IPR001881 1109 1145 SM00179 EGF-like calcium-binding
IPR006210 1112 1145 SM00181 EGF
IPR006210 1157 1190 SM00181 EGF
IPR003645 1157 1179 SM00274 Follistatin-like
IPR001881 1160 1190 SM00179 EGF-like calcium-binding
IPR001791 1213 1349 SM00282 Laminin G
IPR006210 1368 1401 SM00181 EGF
IPR001881 1369 1401 SM00179 EGF-like calcium-binding
IPR006210 1407 1440 SM00181 EGF
IPR003645 1448 1470 SM00274 Follistatin-like
IPR006210 1448 1481 SM00181 EGF
IPR006207 1492 1561 SM00041 Cystine knot
ProfileScan IPR000742 953 988 PS50026 EGF-like
IPR000742 990 1029 PS50026 EGF-like
IPR000742 1031 1067 PS50026 EGF-like
IPR000742 1069 1107 PS50026 EGF-like
IPR000742 1109 1145 PS50026 EGF-like
IPR000742 1154 1190 PS50026 EGF-like
IPR001791 1193 1366 PS50025 Laminin G
IPR000742 1370 1401 PS50026 EGF-like
IPR000742 1404 1440 PS50026 EGF-like
IPR000742 1445 1481 PS50026 EGF-like
IPR006207 1486 1561 PS01225 Cystine knot
ScanRegExp IPR013032 976 987 PS00022 EGF-like region
IPR013032 976 987 PS01186 EGF-like region
IPR013032 1017 1028 PS00022 EGF-like region
IPR013032 1017 1028 PS01186 EGF-like region
IPR001881 1024 1055 PS01187 EGF-like calcium-binding
IPR000152 1046 1057 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1055 1066 PS00022 EGF-like region
IPR013032 1095 1106 PS00022 EGF-like region
IPR013032 1095 1106 PS01186 EGF-like region
IPR001881 1109 1133 PS01187 EGF-like calcium-binding
IPR000152 1124 1135 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1133 1144 PS00022 EGF-like region
IPR013032 1133 1144 PS01186 EGF-like region
IPR013032 1178 1189 PS00022 EGF-like region
IPR013032 1178 1189 PS01186 EGF-like region
IPR013032 1389 1400 PS00022 EGF-like region
IPR013032 1389 1400 PS01186 EGF-like region
IPR013032 1428 1439 PS00022 EGF-like region
IPR013032 1469 1480 PS00022 EGF-like region
IPR013032 1469 1480 PS01186 EGF-like region
IPR006207 1524 1560 PS01185 Cystine knot

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 35 RGVGWQMLSLSLGLVLAILNKVA 57 PRIMARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp