Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11809
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11809
Clone name fh14138
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol OSBPL1A
cDNA sequence DNA sequence (5395 bp)
Predicted protein sequence (549 aa)
Description Oxysterol-binding protein-related protein 1 (OSBP-related protein 1)(ORP-1)
Features of the cloned cDNA sequence

Length: 5395 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1125 bp
Genome contig ID gi51511735r_19896015
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATCTACCTGATGCTAAATAAAGGCTTTAGAATGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCCCAAAAGTGTGGTTTCTTTTAAAATTTCAAATATACTAATGTTGCCAC

Features of the protein sequence

Length: 549 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAH13569 0 100.0 unnamed protein...
Homo sapiens
Q9BXW6 0 100.0 Oxysterol-bindi...
Homo sapiens
AAL40663 0 99.8 oxysterol-bindi...
Homo sapiens
BAF85584 0 99.2 unnamed protein...
Homo sapiens
AAI44118 0 99.6 Oxysterol bindi...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000648 108 541 PF01237 Oxysterol-binding protein
ScanRegExp IPR000648 246 256 PS01013 Oxysterol-binding protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp