Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11811
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11811
Clone name fj00449
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF706
cDNA sequence DNA sequence (4174 bp)
Predicted protein sequence (117 aa)
Description Zinc finger protein 706
Features of the cloned cDNA sequence

Length: 4174 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2197 bp
Genome contig ID gi51511724r_102178460
PolyA signal sequence
(ATTAAA,-7)
+----*----+----*----+----*----+----
TGTGCTGTAATGTCTTATTAAAGAAGATATTAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACTAAACTAGTCTAATTTCTTCTACATTTTAAGAGGTTTTTATATTC

Features of the protein sequence

Length: 117 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW91832 6.5e-27 83.6 zinc finger pro...
Homo sapiens
XP_849011 3.6e-26 98.7 similar to HSPC...
Canis lupus fam...
EDL08813 3.9e-26 97.4 zinc finger pro...
Mus musculus
Q9Y5V0 1.5e-25 100.0 Zinc finger pro...
Homo sapiens
XP_001371700 6.6e-25 98.6 similar to PNAS...
Monodelphis dom...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR015023 43 113 PF08927 Domain of unknown function DUF1909
ScanRegExp IPR007087 82 103 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp