Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11813
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11813
Clone name fj10696
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SMC3
cDNA sequence DNA sequence (4091 bp)
Predicted protein sequence (1242 aa)
Flexi ORF Clone FXC11813
Description Structural maintenance of chromosomes protein 3 (Chondroitin sulfate proteoglycan 6)(Chromosome-associated polypeptide)(hCAP)(Basement membrane-associated chondroitin proteoglycan)(Bamacan)
Features of the cloned cDNA sequence

Length: 4091 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 330 bp
Genome contig ID gi89161187f_112217458
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TTTATAGCTTCAATTAAATAATCGGTTTTATGACT
Flanking genome sequence
(136924 - 136973)
----+----*----+----*----+----*----+----*----+----*
AATATAGTGTTTTATGTGGCTTTTCATTTGTCATAGTCTCTTCCAGTGAG

Features of the protein sequence

Length: 1242 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UQE7 0 100.0 Structural main...
Homo sapiens
BAF98736 0 99.9 unnamed protein...
Homo sapiens
CAD59554 0 99.9 TPA: SMC3 prote...
Bos taurus
Q9CW03 0 99.9 Structural main...
Mus musculus
AAH47324 0 99.9 Structural main...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR003439 1139 1182 PD000006 ABC transporter related
HMMPfam IPR003395 27 1222 PF02463 SMC protein
IPR010935 554 668 PF06470 SMCs flexible hinge
ScanRegExp IPR003439 1140 1154 PS00211 ABC transporter related
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp