Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11817
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11817
Clone name fj22638
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol STAG2
cDNA sequence DNA sequence (4182 bp)
Predicted protein sequence (1239 aa)
Flexi ORF Clone FXC11817
Description Cohesin subunit SA-2 (Stromal antigen 2)(SCC3 homolog 2)
Features of the cloned cDNA sequence

Length: 4182 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 286 bp
Genome contig ID gi89161218f_122822295
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTGGCTTTTGAATCGATTATTTCATGCTTTTTTTT
Flanking genome sequence
(240121 - 240170)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAACAAAATAACAATCTGAAGAGGCATTTGGTACAGAT

Features of the protein sequence

Length: 1239 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8N3U4 0 100.0 Cohesin subunit...
Homo sapiens
XP_864876 0 99.8 similar to stro...
Canis lupus fam...
XP_001249800 0 99.7 similar to stro...
Bos taurus
CAE46006 0 99.8 hypothetical pr...
Homo sapiens
CAE46005 0 99.7 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013721 162 281 PF08514 STAG
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp