ORK11826

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11826

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11826
Clone name	ha06904
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	CA10
cDNA sequence	DNA sequence (3128 bp) Predicted protein sequence (336 aa)
HaloTag ORF Clone	FHC11826
Flexi ORF Clone	FXC11826
Description	Carbonic anhydrase-related protein 10 (Carbonic anhydrase-related protein X)(CA-RP X)(CARP X)(Cerebral protein 15)

Features of the cloned cDNA sequence

Description

Length: 3128 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1263 bp
Genome contig ID	gi51511734r_46962681
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACTGTCAAGAAATCAATAAATGTGTTTAACAAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCAGTACCCATGTCTGACTTTATTGAGAAAGAGGATGCTCCCTGCTGA

Features of the protein sequence

Description

Length: 336 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9NS85	1.1e-144	100.0	Carbonic anhydr...	Homo sapiens
XP_001369692	1.8e-144	99.6	similar to Carb...	Monodelphis dom...
XP_001503286	3.3e-144	99.6	carbonic anhydr...	Equus caballus
XP_415644	4.6e-144	99.3	similar to Carb...	Gallus gallus
XP_002198310	7.4e-144	99.0	carbonic anhydr...	Taeniopygia guttata

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001148	67	307	PD000865	Carbonic anhydrase
HMMPfam	IPR001148	71	309	PF00194	Carbonic anhydrase
ProfileScan	IPR001148	39	309	PS51144	Carbonic anhydrase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp