Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11835
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11835
Clone name hj03610
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ATP6V1C1
cDNA sequence DNA sequence (5019 bp)
Predicted protein sequence (391 aa)
Description V-type proton ATPase subunit C 1 (V-ATPase subunit C 1)(Vacuolar proton pump subunit C 1)
Features of the cloned cDNA sequence

Length: 5019 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3742 bp
Genome contig ID gi51511724f_104002541
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TCTTCTGTTAATGTCAATAAAAGATGGTTTGTCCT
Flanking genome sequence
(151354 - 151403)
----+----*----+----*----+----*----+----*----+----*
AGAAGGTCTATAAATGGTATTATGTTCTGGAGGAAACCTAGCAAAAACTT

Features of the protein sequence

Length: 391 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P21283 1.7e-150 100.0 V-type proton A...
Homo sapiens
CAH93171 5.7e-150 99.7 hypothetical pr...
Pongo abelii
CAH93365 6.6e-150 99.7 hypothetical pr...
Pongo abelii
XP_532295 1.6e-149 99.2 similar to Vacu...
Canis lupus fam...
P21282 1.9e-149 98.9 V-type proton A...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004907 10 385 PF03223 ATPase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp