Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11839
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11839
Clone name pf03857
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZSCAN29
cDNA sequence DNA sequence (6446 bp)
Predicted protein sequence (861 aa)
Description Zinc finger and SCAN domain-containing protein 29 (Zinc finger protein 690)
Features of the cloned cDNA sequence

Length: 6446 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2901 bp
Genome contig ID gi51511731r_41337866
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GATACCATATTAATAAAAATCATGTCTATAAAGTG
Flanking genome sequence
(99796 - 99747)
----+----*----+----*----+----*----+----*----+----*
CCTGGTGTTTCTTGAAGTGTTTATGTGTGTGTGTGTATATATATACACAA

Features of the protein sequence

Length: 861 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_689668 0 100.0 zinc finger and...
Homo sapiens
Q8IWY8 0 100.0 Zinc finger and...
Homo sapiens
BAG53731 0 99.7 unnamed protein...
Homo sapiens
XP_510349 0 99.0 zinc finger pro...
Pan troglodytes
XP_001107835 0 95.1 similar to zinc...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 687 710 PD000003 Zinc finger
IPR007087 715 738 PD000003 Zinc finger
IPR007087 743 766 PD000003 Zinc finger
IPR007087 771 794 PD000003 Zinc finger
IPR007087 799 822 PD000003 Zinc finger
HMMPfam IPR003309 21 116 PF02023 Transcriptional regulator SCAN
IPR007087 687 709 PF00096 Zinc finger
IPR007087 715 737 PF00096 Zinc finger
IPR007087 743 765 PF00096 Zinc finger
IPR007087 771 793 PF00096 Zinc finger
IPR007087 799 821 PF00096 Zinc finger
IPR007087 827 849 PF00096 Zinc finger
HMMSmart IPR003309 23 135 SM00431 Transcriptional regulator SCAN
IPR015880 687 709 SM00355 Zinc finger
IPR015880 715 737 SM00355 Zinc finger
IPR015880 743 765 SM00355 Zinc finger
IPR015880 771 793 SM00355 Zinc finger
IPR015880 799 821 SM00355 Zinc finger
IPR015880 827 849 SM00355 Zinc finger
ProfileScan IPR003309 27 108 PS50804 Transcriptional regulator SCAN
IPR007087 687 714 PS50157 Zinc finger
IPR007087 715 742 PS50157 Zinc finger
IPR007087 743 770 PS50157 Zinc finger
IPR007087 771 798 PS50157 Zinc finger
IPR007087 799 826 PS50157 Zinc finger
IPR007087 827 854 PS50157 Zinc finger
ScanRegExp IPR007087 689 709 PS00028 Zinc finger
IPR007087 717 737 PS00028 Zinc finger
IPR007087 745 765 PS00028 Zinc finger
IPR007087 773 793 PS00028 Zinc finger
IPR007087 801 821 PS00028 Zinc finger
IPR007087 829 849 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp