ORK11842

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11842

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11842
Clone name	pj01570y1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAP3K6
cDNA sequence	DNA sequence (4270 bp) Predicted protein sequence (1343 aa)
Description	Mitogen-activated protein kinase kinase kinase 6 (EC 2.7.11.25)(Apoptosis signal-regulating kinase 2)

Features of the cloned cDNA sequence

Description

Length: 4270 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	212 bp
Genome contig ID	gi89161185r_27454257
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- ACAAAGCGTATTAAACAGAACACTTTTGAACCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTCCTGGCAATTTTGGAGGTGTATGGTGGGAGGGGTATCCTGGGAAGAGC

Features of the protein sequence

Description

Length: 1343 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX07758	99.9	mitogen-activat...	Homo sapiens
O95382	99.8	Mitogen-activat...	Homo sapiens
XP_513244	99.4	mitogen-activat...	Pan troglodytes
JE0363	99.6	mitogen-activat...	Homo sapiens
XP_001111127	96.4	similar to mito...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	708	960	PD000001	Protein kinase
HMMPfam	IPR000719	708	961	PF00069	Protein kinase
HMMSmart	IPR001245	703	959	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	703	961	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	703	961	PS50011	Protein kinase
ScanRegExp	IPR000719	709	732	PS00107	Protein kinase
ScanRegExp	IPR008271	822	834	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp