ORK11899

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11899

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11899
Clone name	ha01943s1
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	DHX9
cDNA sequence	DNA sequence (4282 bp) Predicted protein sequence (1271 aa)
HaloTag ORF Clone	FHC11899
Flexi ORF Clone	FXC11899
Description	ATP-dependent RNA helicase A (EC 3.6.1.-)(Nuclear DNA helicase II)(NDH II)(DEAH box protein 9)

Features of the cloned cDNA sequence

Description

Length: 4282 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	313 bp
Genome contig ID	gi89161185f_180975081
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TCGTTTAATACAATAGAAAATAAAGTATTACACCG
Flanking genome sequence (148426 - 148475)	----+--------+--------+--------+--------+----* AATACTTGCCGTGTAGTTTGTTTGTTGACCTCGTATGTTAGAAAATTTTA

Features of the protein sequence

Description

Length: 1271 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q08211	100.0	ATP-dependent R...	Homo sapiens
Q5R874	99.8	ATP-dependent R...	Pongo abelii
CAA71668	99.6	nuclear DNA hel...	Homo sapiens
XP_001114384	99.2	DEAH (Asp-Glu-A...	Macaca mulatta
A47363	98.0	Sequence 10 fro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001159	5	70	PF00035	Double-stranded RNA binding
	IPR001159	182	251	PF00035	Double-stranded RNA binding
	IPR011545	392	552	PF00270	DNA/RNA helicase
	IPR001650	676	770	PF00271	DNA/RNA helicase
	IPR007502	832	920	PF04408	Helicase-associated region
	IPR011709	959	1076	PF07717	Domain of unknown function DUF1605
HMMSmart	IPR001159	5	71	SM00358	Double-stranded RNA binding
	IPR001159	182	252	SM00358	Double-stranded RNA binding
	IPR014001	384	574	SM00487	DEAD-like helicases
	IPR001650	665	770	SM00490	DNA/RNA helicase
ProfileScan	IPR001159	4	72	PS50137	Double-stranded RNA binding
	IPR001159	181	253	PS50137	Double-stranded RNA binding
	IPR014021	399	565	PS51192	Helicase
	IPR001650	637	810	PS51194	DNA/RNA helicase
ScanRegExp	IPR002464	507	516	PS00690	DNA/RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp