ORK07024

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07024

Order Kazusa clone(s) from :

Accession No	AB209149
Product ID	ORK07024
Clone name	af00036
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SULT1A1
cDNA sequence	DNA sequence (7951 bp) Predicted protein sequence (247 aa)
Description	Sulfotransferase 1A1 (EC 2.8.2.1) (Aryl sulfotransferase 1) (Phenol sulfotransferase 1) (Phenol-sulfating phenol sulfotransferase 1) (P- PST 1) (Thermostable phenol sulfotransferase) (Ts-PST) (HAST1/HAST2) (ST1A3).

Features of the cloned cDNA sequence

Description

Length: 7951 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	230 bp
Genome contig ID	gi51511732r_28424563
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAAAATAAAATAAAATAAAACCAATTTTTAAAAAG
Flanking genome sequence (208539 - 208490)	----+--------+--------+--------+--------+----* AAACTAAGTAACATTTCCTAAACTCCAGGCTTCTTCTCCACTTTTGAGTC

Features of the protein sequence

Description

Length: 247 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92386	1.4e-111	100.0	Phenol-sulfatin...	Homo sapiens
P50225	2.5e-74	93.5	Sulfotransferas...	Homo sapiens
AAA67895	5.5e-74	93.0	phenol sulfotra...	Homo sapiens
XP_001140334	6.4e-74	99.4	similar to sulf...	Pan troglodytes
AAB31317	6.5e-74	93.0	aryl sulfotrans...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000863	75	121	PD001218	Sulphotransferase
HMMPfam	IPR000863	3	240	PF00685	Sulphotransferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	59	PGTGCVVMVLGLSLLPLQVVYVA	81	PRIMARY	23