ORK06030

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06030

Order Kazusa clone(s) from :

Accession No	AB209163
Product ID	ORK06030
Clone name	ah00336
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MPPED2
cDNA sequence	DNA sequence (5591 bp) Predicted protein sequence (280 aa)
Description	Metallophosphoesterase domain-containing protein 2 (Fetal brain protein 239) (239FB).

Features of the cloned cDNA sequence

Description

Length: 5591 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4396 bp
Genome contig ID	gi51511727r_30263054
PolyA signal sequence (None)	+--------+--------+----*----+---- GAACTCCAGCCTGGCAACAGAGCGAGACTCTGTCT
Flanking genome sequence (99562 - 99513)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGAAAAAAGAAAAAAGAACTTGGGTATCCTAAA

Features of the protein sequence

Description

Length: 280 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92400	6.9e-122	100.0	chromosome 11 o...	Homo sapiens
XP_001139555	2.3e-120	100.0	similar to chro...	Pan troglodytes
XP_001086848	3.2e-119	99.2	hypothetical pr...	Macaca mulatta
XP_508348	2.2e-111	100.0	metallophosphoe...	Pan troglodytes
XP_419641	2.5e-111	100.0	hypothetical pr...	Gallus gallus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004843	61	259	PF00149	Metallophosphoesterase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp