ORK07539

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07539

Order Kazusa clone(s) from :

Accession No	AB209458
Product ID	ORK07539
Clone name	ah03136
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SCLY
cDNA sequence	DNA sequence (5653 bp) Predicted protein sequence (235 aa)
Description	selenocysteine lyase

Features of the cloned cDNA sequence

Description

Length: 5653 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4502 bp
Genome contig ID	gi89161199f_238534304
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AAACTAAATTAACGAATAAAAGATTTCAGTGCCCG
Flanking genome sequence (138490 - 138539)	----+--------+--------+--------+--------+----* ACTTGGGGATCCTGTGGTTTCTCTAGTGGGCACTGCGCTTGGGCACAAAG

Features of the protein sequence

Description

Length: 235 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92695	9.8e-96	100.0	selenocysteine ...	Homo sapiens
AAF36816	2.8e-57	97.4	putative seleno...	Homo sapiens
EAW71138	2.8e-57	97.4	selenocysteine ...	Homo sapiens
XP_001086131	3.6e-56	94.9	similar to sele...	Macaca mulatta
AAH00586	1.9e-53	96.6	SCLY protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000192	91	226	PF00266	Aminotransferase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp