Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04026
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209480
Product ID ORK04026
Clone name ah06448
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ACO1
cDNA sequence DNA sequence (5702 bp)
Predicted protein sequence (781 aa)
Description Iron-responsive element-binding protein 1 (IRE-BP 1) (Iron regulatory protein 1) (IRP1) (Ferritin repressor protein) (Aconitate hydratase) (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase).
Features of the cloned cDNA sequence

Length: 5702 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3354 bp
Genome contig ID gi89161216f_32274646
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
CCAGAAGTTTGAGACCAGCCTGGGCAACACTCTAC
Flanking genome sequence
(168140 - 168189)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAATAAATAAATAAATAAATAAAATAAATCAGCCAGGTGTGC

Features of the protein sequence

Length: 781 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92717 0 100.0 aconitase 1 var...
 Homo sapiens
P21399 0 99.8 Cytoplasmic aco...
 Homo sapiens
XP_001155934 0 99.7 aconitase 1 iso...
 Pan troglodytes
2B3X 0 99.8

CAH92985 0 99.0 hypothetical pr...
 Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001030 208 618 PD000511 Aconitate hydratase
FPrintScan IPR001030 179 192 PR00415 Aconitate hydratase
IPR001030 203 211 PR00415 Aconitate hydratase
IPR001030 232 245 PR00415 Aconitate hydratase
IPR001030 246 261 PR00415 Aconitate hydratase
IPR001030 308 321 PR00415 Aconitate hydratase
IPR001030 322 335 PR00415 Aconitate hydratase
IPR001030 404 418 PR00415 Aconitate hydratase
IPR001030 469 480 PR00415 Aconitate hydratase
IPR001030 531 544 PR00415 Aconitate hydratase
HMMPfam IPR001030 91 600 PF00330 Aconitate hydratase
ScanRegExp IPR001030 465 481 PS00450 Aconitate hydratase
IPR001030 531 544 PS01244 Aconitate hydratase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp