Length: 3296 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
2742 bp |
Genome contig ID |
gi42406306f_13008130 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- GATACTGATGAGAATAAACTAAACGCCTTTGTAAC |
Flanking genome sequence (104830 - 104879) |
----+----*----+----*----+----*----+----*----+----* AGCCTTGCCGCATGCTCGTTACTTGGGGGCCCAGGGAGGAACACACACCT |
Length: 183 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
Q96RE7 |
7.9e-81 |
100.0 |
Nucleus accumbe...
|
Homo sapiens
|
XP_001504926 |
1e-76 |
94.5 |
BTB (POZ) domai...
|
Equus caballus
|
XP_001366862 |
1.1e-75 |
92.3 |
similar to NAC1...
|
Monodelphis dom...
|
XP_603731 |
1.3e-75 |
94.5 |
similar to tran...
|
Bos taurus
|
O35260 |
6e-74 |
91.3 |
Nucleus accumbe...
|
Rattus norvegicus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Search method |
interpro_ID |
From |
To |
Entry |
Definition |
HMMPfam |
IPR009552 |
1 |
108 |
PF06665 |
Protein of unknown function DUF1172 |