ORK06980

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06980

Order Kazusa clone(s) from :

Accession No	AB209757
Product ID	ORK06980
Clone name	bh00260
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SPTLC1
cDNA sequence	DNA sequence (5189 bp) Predicted protein sequence (262 aa)
Description	Serine palmitoyltransferase 1 (EC 2.3.1.50) (Long chain base biosynthesis protein 1) (LCB 1) (Serine-palmitoyl-CoA transferase 1) (SPT 1) (SPT1).

Features of the cloned cDNA sequence

Description

Length: 5189 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4399 bp
Genome contig ID	gi89161216r_93753081
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCTAGCCTGGGTGGCAGAGCAAGACTCTGTCTC
Flanking genome sequence (99853 - 99804)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAATCAGTATTGTGCTGTCTTTTGTTAAGTGAAT

Features of the protein sequence

Description

Length: 262 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92994	4e-110	100.0	serine palmitoy...	Homo sapiens
XP_001102219	6.8e-107	98.0	similar to seri...	Macaca mulatta
O15269	1.1e-106	99.6	Serine palmitoy...	Homo sapiens
EAW62806	1.1e-106	99.6	serine palmitoy...	Homo sapiens
AAH68537	1.1e-106	99.6	SPTLC1 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004839	93	256	PF00155	Aminotransferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	18	YHLILEGILILWIIRLLFSKTY	39	PRIMARY	22