ORK04674

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04674

Order Kazusa clone(s) from :

Accession No	AB209705
Product ID	ORK04674
Clone name	bm01140
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CTSA
cDNA sequence	DNA sequence (1862 bp) Predicted protein sequence (497 aa)
Description	Lysosomal protective protein precursor (EC 3.4.16.5) (Cathepsin A) (Carboxypeptidase C) (Protective protein for beta-galactosidase) [Contains: Lysosomal protective protein 32 kDa chain; Lysosomal protective protein 20 kDa chain].

Features of the cloned cDNA sequence

Description

Length: 1862 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	367 bp
Genome contig ID	gi51511747f_43853371
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TAGATTGATTATGGAATTAAATTGGGTACAGCTTC
Flanking genome sequence (107494 - 107543)	----+--------+--------+--------+--------+----* AAATCCCGTCTTCTCTGTGGCACTGGGGGTTAGAGGGGGCACTACAGGCT

Features of the protein sequence

Description

Length: 497 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92942	100.0	carrier family ...	Homo sapiens
CAI20248	99.7	cathepsin A [Ho...	Homo sapiens
XP_001159669	98.9	hypothetical pr...	Pan troglodytes
CAH92374	98.5	hypothetical pr...	Pongo abelii
XP_001106032	97.9	protective prot...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001563	46	497	PD001189	Peptidase S10
FPrintScan	IPR001563	130	142	PR00724	Peptidase S10
	IPR001563	143	153	PR00724	Peptidase S10
	IPR001563	177	202	PR00724	Peptidase S10
	IPR001563	464	477	PR00724	Peptidase S10
HMMPfam	IPR001563	56	494	PF00450	Peptidase S10
ScanRegExp	IPR001563	191	198	PS00131	Peptidase S10
ScanRegExp	IPR001563	464	481	PS00560	Peptidase S10

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	22	AAPPPLFLLLLLLLLVSWASRGE	44	PRIMARY	23