ORK05306

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05306

Order Kazusa clone(s) from :

Accession No	AK226166
Product ID	ORK05306
Clone name	bm01240
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	GMPR2
cDNA sequence	DNA sequence (1984 bp) Predicted protein sequence (383 aa)
Description	GMP reductase 2 (EC 1.7.1.7) (Guanosine 5'-monophosphate oxidoreductase 2) (Guanosine monophosphate reductase 2).

Features of the cloned cDNA sequence

Description

Length: 1984 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	461 bp
Genome contig ID	gi51511730f_23671712
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GAAATACCTCAATAAAGAGAGAGCTCATTGACTGT
Flanking genome sequence (106575 - 106624)	----+--------+--------+--------+--------+----* AAAGAGATGCTGGGGCTTTCTGTACAAGGCTAGCATCTGGGTGCTGCTGC

Features of the protein sequence

Description

Length: 383 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH03053	5.3e-141	100.0	GMPR2 protein [...	Homo sapiens
EAW66055	5.5e-141	100.0	guanosine monop...	Homo sapiens
XP_001168538	3.1e-139	98.8	guanosine monop...	Pan troglodytes
XP_001168784	2.3e-105	83.8	guanosine monop...	Pan troglodytes
XP_001113210	1.6e-104	83.2	guanosine monop...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001093	74	259	PF00478	IMP dehydrogenase/GMP reductase
ScanRegExp	IPR015875	150	162	PS00487	IMP dehydrogenase / GMP reductase site

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	LIYKLFTLKWKMLLLSVLLPASI	38	PRIMARY	23