Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04891
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209773
Product ID ORK04891
Clone name bm01550
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol EML2
cDNA sequence DNA sequence (1988 bp)
Predicted protein sequence (574 aa)
Description Echinoderm microtubule-associated protein-like 2 (EMAP-2) (HuEMAP-2).
Features of the cloned cDNA sequence

Length: 1988 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 261 bp
Genome contig ID gi42406306r_50704550
PolyA signal sequence
(AATAAA,-18)		 
+----*----+----*----+----*----+----
CTTTTATATCATCCAGAAATAAAGACACGTACACT
Flanking genome sequence
(99950 - 99901)		 
----+----*----+----*----+----*----+----*----+----*
AAGGTGTGTCAGGGTCTATGTATTTGTACGGTATGTGCCTACACAGTTGT

Features of the protein sequence

Length: 574 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93010 0 100.0 echinoderm micr...
 Homo sapiens
XP_001165681 0 99.8 echinoderm micr...
 Pan troglodytes
O95834 0 99.8 Echinoderm micr...
 Homo sapiens
XP_001165936 0 99.8 echinoderm micr...
 Pan troglodytes
XP_001165834 0 99.8 echinoderm micr...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001680 298 330 PD000018 WD40 repeat
HMMPfam IPR005108 1 19 PF03451 HELP
IPR001680 20 48 PF00400 WD40 repeat
IPR001680 209 247 PF00400 WD40 repeat
IPR001680 300 330 PF00400 WD40 repeat
IPR001680 375 413 PF00400 WD40 repeat
IPR001680 421 459 PF00400 WD40 repeat
IPR001680 533 572 PF00400 WD40 repeat
HMMSmart IPR001680 19 68 SM00320 WD40 repeat
IPR001680 71 116 SM00320 WD40 repeat
IPR001680 119 158 SM00320 WD40 repeat
IPR001680 164 204 SM00320 WD40 repeat
IPR001680 208 247 SM00320 WD40 repeat
IPR001680 291 330 SM00320 WD40 repeat
IPR001680 333 371 SM00320 WD40 repeat
IPR001680 374 413 SM00320 WD40 repeat
IPR001680 420 459 SM00320 WD40 repeat
IPR001680 485 526 SM00320 WD40 repeat
IPR001680 532 572 SM00320 WD40 repeat
ProfileScan IPR001680 107 574 PS50294 WD40 repeat
IPR001680 215 246 PS50082 WD40 repeat
IPR001680 298 339 PS50082 WD40 repeat
IPR001680 381 422 PS50082 WD40 repeat
IPR001680 427 468 PS50082 WD40 repeat
IPR001680 539 574 PS50082 WD40 repeat
ScanRegExp IPR002048 105 117 PS00018 Calcium-binding EF-hand
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp