Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10377
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10377
Clone name bm01941
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol NAPRT
cDNA sequence DNA sequence (1794 bp)
Predicted protein sequence (493 aa)
Description Nicotinate phosphoribosyltransferase (NAPRTase)(EC 2.4.2.11)(Nicotinate phosphoribosyltransferase domain-containing protein 1)(FHA-HIT-interacting protein)
Features of the cloned cDNA sequence

Length: 1794 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 311 bp
Genome contig ID gi51511724r_144628099
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CACTCACTTTTCCCCACAAAAAAAAAAAAAAAAAA
Flanking genome sequence
(89599 - 89550)
----+----*----+----*----+----*----+----*----+----*
AAAGGCCAGGCGCGGTGGCTCACGCCTGTAAACCCAGCACTTTGGGAGGC

Features of the protein sequence

Length: 493 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW82240 1.8e-192 100.0 nicotinate phos...
Homo sapiens
Q6XQN6 2.9e-190 99.1 Nicotinate phos...
Homo sapiens
EAW82239 3.1e-190 99.1 nicotinate phos...
Homo sapiens
AAP69604 5.1e-190 98.9 nicotinate phos...
Homo sapiens
AAP69603 5.3e-190 98.9 nicotinate phos...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007229 166 431 PF04095 Nicotinate phosphoribosyltransferase and related
HMMTigr IPR006405 18 493 TIGR01513 Nicotinate phosphoribosyltransferase related
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp