ORK04561

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04561

Order Kazusa clone(s) from :

Accession No	AB209788
Product ID	ORK04561
Clone name	bm02860
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CHN1
cDNA sequence	DNA sequence (1852 bp) Predicted protein sequence (296 aa)
Description	N-chimaerin (NC) (N-chimerin) (Alpha chimerin) (A-chimaerin) (Rho GTPase-activating protein 2).

Features of the cloned cDNA sequence

Description

Length: 1852 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	621 bp
Genome contig ID	gi89161199r_175272469
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAAGGTTATCCATACCAATAAAAAGTGTACAACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCATTTTCTGTTAAATTATTATTGGTTTTCAGTTGTAATTTGGTATTTT

Features of the protein sequence

Description

Length: 296 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93025	4e-129	100.0	chimerin (chima...	Homo sapiens
EAX11120	2.8e-119	98.2	chimerin (chima...	Homo sapiens
S08242	4e-119	99.6	N-chimerin - human.	Homo sapiens
XP_001092066	4.4e-119	99.6	chimerin (chima...	Macaca mulatta
BAE90693	4.4e-119	99.6	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002219	40	54	PR00008	Protein kinase C
	IPR002219	56	65	PR00008	Protein kinase C
	IPR002219	69	80	PR00008	Protein kinase C
	IPR002219	81	93	PR00008	Protein kinase C
HMMPfam	IPR002219	43	95	PF00130	Protein kinase C
HMMPfam	IPR000198	119	273	PF00620	RhoGAP
HMMSmart	IPR002219	43	92	SM00109	Protein kinase C
HMMSmart	IPR000198	116	293	SM00324	RhoGAP
ProfileScan	IPR002219	42	92	PS50081	Protein kinase C
ProfileScan	IPR000198	105	296	PS50238	RhoGAP
ScanRegExp	IPR002219	43	92	PS00479	Protein kinase C

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp