ORK10380

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10380

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10380
Clone name	bm03166
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	BDH1
cDNA sequence	DNA sequence (1567 bp) Predicted protein sequence (376 aa)
HaloTag ORF Clone	FHC10380
Flexi ORF Clone	FXC10380
Description	D-beta-hydroxybutyrate dehydrogenase, mitochondrial Precursor (BDH)(EC 1.1.1.30)(3-hydroxybutyrate dehydrogenase)

Features of the cloned cDNA sequence

Description

Length: 1567 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	319 bp
Genome contig ID	gi89161205r_198622844
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- ATCTTTATATTAAAAACAGATCTCATTTGATCCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCCAGTCTCATGAATGAAAAGGACAGGTTTTTTTCTTTTGTAAATGAA

Features of the protein sequence

Description

Length: 376 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q02338	6.6e-142	100.0	D-beta-hydroxyb...	Homo sapiens
AAH11964	1.2e-141	99.7	3-hydroxybutyra...	Homo sapiens
AAA58352	1.5e-131	96.1	(R)-3-hydroxybu...	Homo sapiens
XP_516981	1.2e-129	99.3	3-hydroxybutyra...	Pan troglodytes
XP_001166717	1.4e-129	99.3	3-hydroxybutyra...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002347	90	107	PR00081	Glucose/ribitol dehydrogenase
	IPR002347	169	180	PR00081	Glucose/ribitol dehydrogenase
	IPR002198	169	180	PR00080	Short-chain dehydrogenase/reductase SDR
	IPR002347	215	231	PR00081	Glucose/ribitol dehydrogenase
	IPR002198	221	229	PR00080	Short-chain dehydrogenase/reductase SDR
	IPR002347	241	260	PR00081	Glucose/ribitol dehydrogenase
	IPR002198	241	260	PR00080	Short-chain dehydrogenase/reductase SDR
	IPR002347	262	279	PR00081	Glucose/ribitol dehydrogenase
HMMPfam	IPR002198	89	260	PF00106	Short-chain dehydrogenase/reductase SDR
ScanRegExp	IPR002198	228	256	PS00061	Short-chain dehydrogenase/reductase SDR

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp