ORK06858

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06858

Order Kazusa clone(s) from :

Accession No	AB209822
Product ID	ORK06858
Clone name	bm04642
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SLC25A6
cDNA sequence	DNA sequence (1345 bp) Predicted protein sequence (323 aa)
Description	ADP/ATP translocase 3 (Adenine nucleotide translocator 2) (ANT 3) (ADP,ATP carrier protein 3) (Solute carrier family 25 member 6) (ADP,ATP carrier protein, isoform T2).

Features of the cloned cDNA sequence

Description

Length: 1345 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	356 bp
Genome contig ID	gi89161218r_1365139
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAACAAAAGAATCACGTTTTCCCATTTGTACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCGCTAGCCCCTGTTTTGCACAGCCGAGTACTGGCGAGTATGTTCTATG

Features of the protein sequence

Description

Length: 323 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93059	4.7e-137	100.0	ADP,ATP carrier...	Homo sapiens
XP_537947	2.1e-127	94.7	similar to ADP/...	Canis lupus fam...
P12236	7.2e-127	100.0	ADP/ATP translo...	Homo sapiens
AAH14775	2.5e-126	99.6	Solute carrier ...	Homo sapiens
ACC93605	3.7e-125	97.9	SLC25A6 [Ovis a...	Ovis aries

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002113	33	45	PR00927	Adenine nucleotide translocator 1
	IPR002067	36	49	PR00926	Mitochondrial carrier protein
	IPR002030	38	50	PR00784	Mitochondrial brown fat uncoupling protein
	IPR002067	49	63	PR00926	Mitochondrial carrier protein
	IPR002030	64	83	PR00784	Mitochondrial brown fat uncoupling protein
	IPR002113	76	97	PR00927	Adenine nucleotide translocator 1
	IPR002067	98	118	PR00926	Mitochondrial carrier protein
	IPR002113	109	121	PR00927	Adenine nucleotide translocator 1
	IPR002113	136	149	PR00927	Adenine nucleotide translocator 1
	IPR002067	151	169	PR00926	Mitochondrial carrier protein
	IPR002113	177	198	PR00927	Adenine nucleotide translocator 1
	IPR002030	189	206	PR00784	Mitochondrial brown fat uncoupling protein
	IPR002067	199	217	PR00926	Mitochondrial carrier protein
	IPR002113	238	254	PR00927	Adenine nucleotide translocator 1
	IPR002067	242	264	PR00926	Mitochondrial carrier protein
	IPR002113	290	305	PR00927	Adenine nucleotide translocator 1
	IPR002030	311	323	PR00784	Mitochondrial brown fat uncoupling protein
HMMPfam	IPR001993	32	128	PF00153	Mitochondrial substrate carrier
	IPR001993	137	231	PF00153	Mitochondrial substrate carrier
	IPR001993	234	323	PF00153	Mitochondrial substrate carrier
ProfileScan	IPR001993	31	123	PS50920	Mitochondrial substrate carrier
	IPR001993	136	226	PS50920	Mitochondrial substrate carrier
	IPR001993	237	322	PS50920	Mitochondrial substrate carrier

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp