Length: 1830 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
1238 bp |
Genome contig ID |
gi51511727f_122138320 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- TCATTGTTGGAATCTGAATAAACCAATTACAAAAT |
Flanking genome sequence (110237 - 110286) |
----+----*----+----*----+----*----+----*----+----* AACATATGTGCACATTGTAAGTCTGTAATTTGTGATAGGGGCCAGATCCA |
Length: 196 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD93067 |
1.5e-70 |
100.0 |
class-I MHC-res...
|
Homo sapiens
|
O95727 |
1.4e-62 |
96.7 |
Cytotoxic and r...
|
Homo sapiens
|
AAC80267 |
2.2e-62 |
96.2 |
class-I MHC-res...
|
Homo sapiens
|
XP_001136009 |
2.5e-62 |
96.2 |
class-I MHC-res...
|
Pan troglodytes
|
BAG36349 |
3.9e-62 |
95.7 |
unnamed protein...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
4 |
WVKLLSIVAEFCFSPFLVTDEET |
26 |
SECONDARY |
23 |
2 |
90 |
GILLLTLVSFLIFILFIIVQLFI |
112 |
PRIMARY |
23 |