ORK02698

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02698

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02698
Clone name	bn02174
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	GAPDH
cDNA sequence	DNA sequence (1272 bp) Predicted protein sequence (356 aa)
HaloTag ORF Clone	FHC02698
Flexi ORF Clone	FXC02698
Description	glyceraldehyde-3-phosphate dehydrogenase

Features of the cloned cDNA sequence

Description

Length: 1272 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	200 bp
Genome contig ID	gi89161190f_6413956
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TCATGTACCATCAATAAAGTACCCTGTGCTCAACC
Flanking genome sequence (103843 - 103892)	----+--------+--------+--------+--------+----* AGTTACTTGTCCTGTCTTATTCTAGGGTCTGGGGCAGAGGGGAGGGAAGC

Features of the protein sequence

Description

Length: 356 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P04406	3.1e-138	100.0	Glyceraldehyde-...	Homo sapiens
AAP36549	3.1e-138	100.0	glyceraldehyde-...	synthetic construct
1ZNQ	3.1e-138	100.0	Glyceraldehyde-...	Homo sapiens
CAA25833	6.7e-138	99.7	glyceraldehyde-...	Homo sapiens
AAV33305	2e-137	99.4	aging-associate...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000173	132	145	PR00078	Glyceraldehyde 3-phosphate dehydrogenase
	IPR000173	167	185	PR00078	Glyceraldehyde 3-phosphate dehydrogenase
	IPR000173	194	210	PR00078	Glyceraldehyde 3-phosphate dehydrogenase
	IPR000173	251	268	PR00078	Glyceraldehyde 3-phosphate dehydrogenase
	IPR000173	291	306	PR00078	Glyceraldehyde 3-phosphate dehydrogenase
HMMPfam	IPR000173	25	173	PF00044	Glyceraldehyde 3-phosphate dehydrogenase
HMMPfam	IPR000173	178	335	PF02800	Glyceraldehyde 3-phosphate dehydrogenase
HMMTigr	IPR006424	26	347	TIGR01534	Glyceraldehyde-3-phosphate dehydrogenase
ScanRegExp	IPR000173	171	178	PS00071	Glyceraldehyde 3-phosphate dehydrogenase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp