ORK11795

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11795

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11795
Clone name	ee03533
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	RGS3
cDNA sequence	DNA sequence (3221 bp) Predicted protein sequence (814 aa)
Description	Regulator of G-protein signaling 3 (RGS3)(RGP3)

Features of the cloned cDNA sequence

Description

Length: 3221 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	776 bp
Genome contig ID	gi89161216f_115209455
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGTTCTGGAGCAAATAAAAGGCCTGTGTTATTTCT
Flanking genome sequence (190377 - 190426)	----+--------+--------+--------+--------+----* TGTTCTTGACCCTTTTTGTGTGTTCCTGGTCTTGAGCCTTCCCAGGGTGG

Features of the protein sequence

Description

Length: 814 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH70841	100.0	regulator of G-...	Homo sapiens
EAW87390	100.0	regulator of G-...	Homo sapiens
EAW87389	100.0	regulator of G-...	Homo sapiens
CAH70102	100.0	regulator of G-...	Homo sapiens
P49796	100.0	Regulator of G-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	346	433	PD297513	NULL
BlastProDom	IPR000342	709	809	PD001580	Regulator of G protein signalling
FPrintScan	IPR000342	686	707	PR01301	Regulator of G protein signalling
	IPR000342	708	726	PR01301	Regulator of G protein signalling
	IPR000342	737	760	PR01301	Regulator of G protein signalling
	IPR000342	779	798	PR01301	Regulator of G protein signalling
HMMPfam	IPR000342	689	805	PF00615	Regulator of G protein signalling
HMMSmart	IPR000342	689	805	SM00315	Regulator of G protein signalling
ProfileScan	IPR000342	689	805	PS50132	Regulator of G protein signalling

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp