Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01213
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01213
Clone name ef00431
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PTPRF
cDNA sequence DNA sequence (7673 bp)
Predicted protein sequence (1918 aa)
Flexi ORF Clone FXC01213
Description Receptor-type tyrosine-protein phosphatase F precursor (EC 3.1.3.48) (LAR protein) (Leukocyte antigen related).
Features of the cloned cDNA sequence

Length: 7673 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1661 bp
Genome contig ID gi89161185f_43669251
PolyA signal sequence
(AATAAA,-28)		 
+----*----+----*----+----*----+----
TGATGGTAATAAATTTGAATAATCAGATTTCTTAC
Flanking genome sequence
(192672 - 192721)		 
----+----*----+----*----+----*----+----*----+----*
AAACCAGGACTCTGTCTCAGCTGTTTCTGGAACCAAAGAGTCTGGGCCAA

Features of the protein sequence

Length: 1918 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD66835 0 100.0 LAR [Homo sapiens].
 Homo sapiens
CAI14895 0 100.0 protein tyrosin...
 Homo sapiens
AAH48768 0 99.9 Protein tyrosin...
 Homo sapiens
XP_001173891 0 99.5 protein tyrosin...
 Pan troglodytes
XP_001173913 0 99.7 protein tyrosin...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR003962 641 650 PR00014 Fibronectin
IPR003962 656 666 PR00014 Fibronectin
IPR003962 881 899 PR00014 Fibronectin
IPR003962 899 913 PR00014 Fibronectin
IPR000242 1415 1422 PR00700 Protein-tyrosine phosphatase
IPR000242 1431 1451 PR00700 Protein-tyrosine phosphatase
IPR000242 1515 1532 PR00700 Protein-tyrosine phosphatase
IPR000242 1554 1572 PR00700 Protein-tyrosine phosphatase
IPR000242 1585 1600 PR00700 Protein-tyrosine phosphatase
IPR000242 1601 1611 PR00700 Protein-tyrosine phosphatase
HMMPfam IPR013098 53 144 PF07679 Immunoglobulin I-set
IPR013098 155 245 PF07679 Immunoglobulin I-set
IPR013098 252 335 PF07679 Immunoglobulin I-set
IPR003961 339 421 PF00041 Fibronectin
IPR003961 433 520 PF00041 Fibronectin
IPR003961 532 614 PF00041 Fibronectin
IPR003961 626 716 PF00041 Fibronectin
IPR003961 728 820 PF00041 Fibronectin
IPR003961 832 915 PF00041 Fibronectin
IPR003961 926 1011 PF00041 Fibronectin
IPR000242 1386 1617 PF00102 Protein-tyrosine phosphatase
IPR000242 1675 1908 PF00102 Protein-tyrosine phosphatase
HMMSmart IPR003599 59 145 SM00409 Immunoglobulin subtype
IPR003598 65 134 SM00408 Immunoglobulin subtype 2
IPR003599 161 246 SM00409 Immunoglobulin subtype
IPR003598 167 234 SM00408 Immunoglobulin subtype 2
IPR003599 258 336 SM00409 Immunoglobulin subtype
IPR003598 264 325 SM00408 Immunoglobulin subtype 2
IPR003961 339 418 SM00060 Fibronectin
IPR003961 434 517 SM00060 Fibronectin
IPR003961 532 611 SM00060 Fibronectin
IPR003961 626 713 SM00060 Fibronectin
IPR003961 729 817 SM00060 Fibronectin
IPR003961 832 912 SM00060 Fibronectin
IPR003961 927 1008 SM00060 Fibronectin
IPR003961 1023 1099 SM00060 Fibronectin
IPR000242 1362 1620 SM00194 Protein-tyrosine phosphatase
IPR003595 1516 1617 SM00404 Protein-tyrosine phosphatase
IPR000242 1649 1911 SM00194 Protein-tyrosine phosphatase
IPR003595 1805 1908 SM00404 Protein-tyrosine phosphatase
ProfileScan IPR007110 53 143 PS50835 Immunoglobulin-like
IPR007110 155 244 PS50835 Immunoglobulin-like
IPR007110 252 334 PS50835 Immunoglobulin-like
IPR003961 339 427 PS50853 Fibronectin
IPR003961 433 526 PS50853 Fibronectin
IPR003961 532 622 PS50853 Fibronectin
IPR003961 626 723 PS50853 Fibronectin
IPR003961 728 826 PS50853 Fibronectin
IPR003961 828 921 PS50853 Fibronectin
IPR003961 926 1019 PS50853 Fibronectin
IPR003961 1022 1106 PS50853 Fibronectin
IPR000242 1363 1618 PS50055 Protein-tyrosine phosphatase
IPR000387 1538 1609 PS50056 Protein-tyrosine phosphatase
IPR000242 1650 1909 PS50055 Protein-tyrosine phosphatase
IPR000387 1827 1900 PS50056 Protein-tyrosine phosphatase
ScanRegExp IPR000387 1557 1569 PS00383 Protein-tyrosine phosphatase
IPR000387 1848 1860 PS00383 Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 29 RTMVPLVPALVMLGLVAGAHGDS 51 SECONDARY 23
2 1273 LWVTGPVLAVILIILIVIAILLF 1295 PRIMARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp