ORK07560

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07560

Order Kazusa clone(s) from :

Accession No	AB209842
Product ID	ORK07560
Clone name	ef00702
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	TGFB2
cDNA sequence	DNA sequence (8420 bp) Predicted protein sequence (267 aa)
Description	Homo sapiens mRNA for transforming growth factor, beta 2 variant protein.

Features of the cloned cDNA sequence

Description

Length: 8420 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	6323 bp
Genome contig ID	gi89161185f_216485423
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCGACAGAGCCAAATTCAGTCTC
Flanking genome sequence (166408 - 166457)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAATAGCAGGCCCAGAAATGACACAGCATCACTTT

Features of the protein sequence

Description

Length: 267 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93079	6.5e-116	100.0	transforming gr...	Homo sapiens
AAA50404	5.3e-81	99.0	transforming gr...	Homo sapiens
XP_001489417	1.8e-80	98.0	similar to tran...	Equus caballus
XP_545713	2.2e-80	98.0	similar to tran...	Canis lupus fam...
AAR06973	3.7e-78	96.0	transforming gr...	Oryctolagus cun...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003940	3	24	PR01425	Transforming growth factor
	IPR003911	9	28	PR01423	Transforming growth factor beta TGFb
	IPR003940	51	70	PR01425	Transforming growth factor
	IPR003911	63	75	PR01423	Transforming growth factor beta TGFb
	IPR003940	77	99	PR01425	Transforming growth factor
	IPR003940	145	160	PR01425	Transforming growth factor
	IPR003940	181	192	PR01425	Transforming growth factor
	IPR003911	190	204	PR01423	Transforming growth factor beta TGFb
HMMPfam	IPR001111	25	266	PF00688	Transforming growth factor beta (TGFb)

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	5	CVLSAFLILHLVTVALSLSTCST	27	PRIMARY	23
SOSUI2	2	195	IELYQVMFICCCCCCCCCCFRQT	217	PRIMARY	23