Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06933
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209736
Product ID ORK06933
Clone name ef04758
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SNX9
cDNA sequence DNA sequence (7717 bp)
Predicted protein sequence (349 aa)
Description Sorting nexin-9 (SH3 and PX domain-containing protein 1) (Protein SDP1) (SH3 and PX domain-containing protein 3A).
Features of the cloned cDNA sequence

Length: 7717 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 6667 bp
Genome contig ID gi89161210f_158137952
PolyA signal sequence
(AGTAAA,-29)
+----*----+----*----+----*----+----
CTGTACAGTAAATTCTCAAAGCACTTTTTCAAAAC
Flanking genome sequence
(147605 - 147654)
----+----*----+----*----+----*----+----*----+----*
ACTTTTTGGACTTTGTGTGTGATTTTTGTTGTTGTTGTTAAGTACTTTTT

Features of the protein sequence

Length: 349 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92973 7.2e-150 100.0 sorting nexin 9...
Homo sapiens
XP_001144575 9.7e-149 100.0 sorting nexin 9...
Pan troglodytes
XP_001144646 1.1e-148 100.0 sorting nexin 9...
Pan troglodytes
AAH05022 1.1e-148 100.0 Sorting nexin 9...
Homo sapiens
BAG36992 1.1e-148 100.0 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001683 112 222 PF00787 Phox-like
HMMSmart IPR001683 112 222 SM00312 Phox-like
ProfileScan IPR001683 115 226 PS50195 Phox-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp