ORK04648

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04648

Order Kazusa clone(s) from :

Accession No	AB209896
Product ID	ORK04648
Clone name	eg01788
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	YBX3
cDNA sequence	DNA sequence (6394 bp) Predicted protein sequence (134 aa)
Description	DNA-binding protein A (Cold shock domain-containing protein A) (Single-strand DNA-binding protein NF-GMB).

Features of the cloned cDNA sequence

Description

Length: 6394 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	5988 bp
Genome contig ID	gi89161190r_10643093
PolyA signal sequence (None)	+--------+--------+----*----+---- GGATGCTGGTGCTAAACCTCCAAGTGTCATGATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAATTTATGTCCTTCTTATTTATTTCTAGGATGAGGGGA

Features of the protein sequence

Description

Length: 134 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93133	1.5e-53	100.0	CSDA protein va...	Homo sapiens
AAH15913	3.6e-48	100.0	CSDA protein [H...	Homo sapiens
P16989	4.1e-48	100.0	DNA-binding pro...	Homo sapiens
XP_520744	5.9e-48	100.0	similar to DNA-...	Pan troglodytes
AAA79243	8.6e-48	99.1	DNA-binding pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002059	44	91	PD000621	Cold-shock protein
FPrintScan	IPR002059	26	41	PR00050	Cold-shock protein
	IPR002059	47	56	PR00050	Cold-shock protein
	IPR002059	66	84	PR00050	Cold-shock protein
HMMPfam	IPR002059	23	93	PF00313	Cold-shock protein
HMMSmart	IPR011129	25	93	SM00357	Cold shock protein
ScanRegExp	IPR002059	37	56	PS00352	Cold-shock protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp