ORK10399

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10399

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10399
Clone name	ej00452
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SMPD4
cDNA sequence	DNA sequence (4139 bp) Predicted protein sequence (860 aa)
Description	Sphingomyelin phosphodiesterase 4 (EC 3.1.4.12)(Neutral sphingomyelinase 3)(nSMase-3)(nSMase3)(Neutral sphingomyelinase III)

Features of the cloned cDNA sequence

Description

Length: 4139 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1146 bp
Genome contig ID	gi89161199r_130525452
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GACCATGGATCTGAATAAACATGTCCTTGCTTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCTTCTGGCACCTGGGCTCAGTCTCTAGGAGGTTCACCTGTACAGAGT

Features of the protein sequence

Description

Length: 860 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_060221	100.0	sphingomyelin p...	Homo sapiens
EAW55601	99.7	hypothetical pr...	Homo sapiens
BAA91070	100.0	unnamed protein...	Homo sapiens
XP_001929624	88.3	sphingomyelin p...	Sus scrofa
EDK97472	88.2	sphingomyelin p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	822	VASLFCVGPLPCTLLLTLGYVLY	844	PRIMARY	23